Single Colony PCR

Here is the image from the single colony PCR run last night 11/23! The lysis protocol was successful, as was the PCR. Still there is a faint band in the negative control but we have come to expect this. Next steps will be to continue PCR on the other 40+ colonies and perform the lysis procedure on the colonies restreaked for single colonies.
Ayanna

PCR Results Gel, take 3

This gel shows the results of the last PCR run, contrasted against a new one from this afternoon. In both cases, the amount of product that was run was decreased from 5 to 2 ul. Unfortunately, there is still a visible band in the negative control position. Also, band six does not show great amplification. However, it also does not show the excess primers that the negative controls demonstrate. It could be possible that either something was off when the PCR reaction was set, such as fewer primers, or I made a mistake when loading the gel, and somehow got less product from this sample into the well.

Photos of Plates Incubated for 48 hours (11/10)

sorry for the delay, guys.

PCR test run, 2nd gel. 11/16

In this image, you can see the results of our direct colony PCR, using the ready-to-go beads. This gel is much better than the one from earlier today, however, it still shows some signs of contamination in the negative control. It should be noted that although there is contamination, the band is much lighter than the others, and significantly more primers remain in that band than in others. All the bands are at the expected 500 bp.

Gel 11/12

This is a gel of the colony PCR done 11/12/08.
7 samples were run from 4 colony types. The single sample from the large yellow colony did not amplify. Two colonies were picked from each of the other 3 types, and at least 1 amplified for each. The negative control is clean.

It remains to be seen whether this is a problem with the lysis procedure or with the PCR set-up.

Frances

Batch analysis of sequence data

So Reid and I think we've found a good way to batch-analyze all the sequence data we'll be getting back from WashU.

Steps:
1) Convert chromatogram reads to sequence files in FASTA format:
We may not have to worry about this step, as we can probably just ask WashU to send us FASTA files for our sequences. Currently, to do it ourselves, we have to open each file individually with FinchTV and use File-->Export-->DNA Sequence:FASTA.

2) Convert individual FASTA-formatted sequence files to one large Multi-FASTA file containing all the sequences:
FASTA sequence is just a way formatting a plaintext file so that it can be understood by databases such as NCBI. For each entry, the first line contains a ">" symbol followed by the name you want to give that sequence (no space between ">" and the name). The sequence is on the next line. (FASTA can be used for both nucleotide and amino acid sequences; for more info, visit wikipedia: http://en.wikipedia.org/wiki/Fasta_format)
I found a freeware tool that can take a folder full of FASTA sequence files and process it into a Multi-FASTA file. It is available here: http://3d2f.com/download/48-830-fasta-converter-free-download.shtml.Click on the link I've indicated in the screenshot to download.
To use the program, select a folder the folder containing the sequence files you want to merge, and click Start. Make sure you have selected "All files" in the drop-down menu; otherwise, the program only looks for .fasta files and not other sequence files. The program automatically puts the merged file in the same folder as the individual files.

3) Analyze and classify using greengenes:
Greengenes (http://greengenes.lbl.gov/cgi-bin/nph-index.cgi)is a tool for batch analysis of 16S rDNA sequences--exactly what we need to do! It analyzes and prunes your input sequences (in multi-FASTA format) to things that it agrees are 16S genes. It then compares those sequences to several databases of 16S rDNAs and produces a nifty spreadsheet telling you what group (often genus; species if you're lucky) each sequence belongs to.
To align your multi-FASTA sequences, go to the align icon at the top of the greengenes homepage. Upload your file, enter your email address, and hit "Process Fasta File". We are still working on figuring out what all the parameters on the page do, but adjusting "Significant Match Requirements" to minimum length of 250 or 300 allows it to process more of our files--it throws out any that are shorter than that.
Within a few minutes the program will send you an email with the subject line "Greengenes: Your NAST-aligned sequences". You will need Stuffit Expander to open the attached .tgz file. If you didn't change anything under "Files you desire" when doing the alignment, this file will contain a file with all your NAST-aligned sequences in FASTA format (lots of dots and dashes), as well as a spreadsheet summarizing what sequences the program kept and which it threw out (eg, for being too short).
Now return to Greengenes and go to the "Compare" icon at the top of the page. Click on "classify" (third bullet point) Upload your NAST-aligned FASTA file, enter your email address, and click "Classify Batch".
You will receive an email with the subject "greengenes classification results" and an excel file attached that classifies all your sequences!


The End.

I hope this post wasn't too long/boring/unnecessarily detailed.
Please feel free to add anything I forgot or any tips you may come across as we start getting sequences back in a few weeks!
~Frances

Lasergene Manual

So, in anticipation of successful results from sequencing, here is the link to the Lasergene manual. The stuff about running BLAST searches starts on page 8.

PCR Cleanup, 11.6

PCR cleanup appears to have been successful. No primers remain, and there are products from all four cleanups. See the note in the photo regarding band intensity. Ready for ligations, once concentrations and ligation procedure has been finalized.

Gel of PCR products from this morning. All but one of the elution 1 samples amplified. The scan isn't very good, but looking at the hard copy it is possible to see that all elution 2 samples amplified. We plan to pool elution 1 and all elution 2 samples and do PCR clean-up.

E & F

PCR Cleanup, gel image

Image from gels with PCR cleanup products. These products represent S2, S7, A2 and A7, all from elution two. Based on the ladder, the clean product appears to be around 500 bp in length.

Hey everyone,

Ok, so here's is the gel from our second try at PCR - YAY! If you click on the image you can see it much larger and you'll notice that we seem to have DNA from all of the second elutions from the DNA extraction and one from the first elution.

Because this looks promising, we're going to proceed with our PCR clean up and then run the second gel. We will report back later.

-M

Recap of 11/5

Here's a quick recap of what we did this afternoon, just so we have it on record. Please add to it or change anything that isn't quite right--I'm sure I don't remember everything!

-PCR using universal bacterial primers (Forward: cggcccagactcctacgggaggcagcag; reverse: gcgtggactaccagggtatctaatcc) on DNA extractions from S2, S7, A2, A7 lines. Separate reactions for elution 1 and elution 2 of each. Positive control was E. coli chromosomal DNA, negative control was sterile water in place of the DNA sample.

In the future, we will probably want to use a separate set of pipetmen to set up PCR reactions and keep PCR products away from the area where we set up the reactions to avoid any possible contamination.

-Compared our primers to Symbiodinium chloroplast 18S rDNA--it looks like we don't have to worry about amplifying chloroplast DNA, since none of the primers had more than about ~8 bases in common with any one part of the chloroplast 18S sequence. (Reid, if you could add some details about how you did the multiple sequence comparisons either here or in a lab notebook, it might be handy to have that info when we start getting sequences back to analyze.)

-Poured gels to analyze PCR products tonight. In particular, we are hoping to see a clean negative control.

-Sent another email to William Courtney at WashU sequencing center to ask final questions about how to submit our samples.

-Sterilized more water.

F

New Papers

Hi Everyone,
After the convo in class today, I continued to obsess about our primer sources. I re-read some papers I found during my work with Liz, and am still thinking we are ok. I will put the papers in the binder. See the one called Dinoflagellate chloroplasts - where have all the genes gone?.

However, on a very positive note I am pretty certain our sonicating wont do anything. I read a paper in which they quantified the effects of sonfication on bacteria, and found it did nothing. And they really did it for a long time (around 60s of actual sonic energy).

So check the binder and flip thru these papers when you have a chance.
RW

Gel PCR